KEGG   Homo sapiens (human): 407045Help
Entry
407045            miRNA     T01001                                 

Gene name
MIR7-3, MIRN7-3, hsa-mir-7-3, mir-7-3
Definition
(RefSeq) microRNA 7-3
  KO
K17365  microRNA 7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407045 (MIR7-3)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407045 (MIR7-3)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407045 (MIR7-3)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407045
HGNC: 31640
Ensembl: ENSG00000207630
miRBase: MI0000265
LinkDB All DBs
Position
19p13.3
NT seq 24 nt NT seq  +upstreamnt  +downstreamnt
tggaagactagtgattttgttgtt

DBGET integrated database retrieval system