KEGG   Homo sapiens (human): 407048Help
Entry
407048            miRNA     T01001                                 

Gene name
MIR92A1, C13orf25, MIR17HG, MIR92-1, MIRH1, MIRHG1, MIRN92-1, MIRN92A-1, MIRN92A1, miRNA92-1, mir-92a-1
Definition
(RefSeq) microRNA 92a-1
  KO
K17008  microRNA 92a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407048 (MIR92A1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407048 (MIR92A1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407048 (MIR92A1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   407048 (MIR92A1)
  Exosomal RNA of colorectal cancer cells
   407048 (MIR92A1)
  Exosomal RNA of renal carcinoma cells
   407048 (MIR92A1)
  Exosomal RNA of other cancer cells
   407048 (MIR92A1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407048 (MIR92A1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407048
OMIM: 609422
HGNC: 31643
Ensembl: ENSG00000283705
miRBase: MI0000093
LinkDB All DBs
Position
13q31.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
aggttgggatcggttgcaatgct

DBGET integrated database retrieval system