KEGG   Homo sapiens (human): 407049Help
Entry
407049            miRNA     T01001                                 

Gene name
MIR92A2, MIRN92-2, MIRN92A-2, MIRN92A2, mir-92a-2
Definition
(RefSeq) microRNA 92a-2
  KO
K17008  microRNA 92a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407049 (MIR92A2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407049 (MIR92A2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407049 (MIR92A2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   407049 (MIR92A2)
  Exosomal RNA of colorectal cancer cells
   407049 (MIR92A2)
  Exosomal RNA of renal carcinoma cells
   407049 (MIR92A2)
  Exosomal RNA of other cancer cells
   407049 (MIR92A2)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407049 (MIR92A2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407049
HGNC: 31644
Ensembl: ENSG00000284538
miRBase: MI0000094
LinkDB All DBs
Position
Xq26.2
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
gggtggggatttgttgcattac

DBGET integrated database retrieval system