KEGG   Homo sapiens (human): 407053Help
Entry
407053            miRNA     T01001                                 

Gene name
MIR96, DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96
Definition
(RefSeq) microRNA 96
  KO
K17114  microRNA 96
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Disease
H00604  Deafness, autosomal dominant
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407053 (MIR96)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407053 (MIR96)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407053 (MIR96)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of haemopoietic cells
   407053 (MIR96)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407053 (MIR96)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407053
OMIM: 611606
HGNC: 31648
Ensembl: ENSG00000199158
miRBase: MI0000098
LinkDB All DBs
Position
7q32.2
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
tttggcactagcacatttttgct

DBGET integrated database retrieval system