KEGG   Homo sapiens (human): 407055Help
Entry
407055            miRNA     T01001                                 

Gene name
MIR99A, MIRN99A, mir-99a
Definition
(RefSeq) microRNA 99a
  KO
K17367  microRNA 99a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407055 (MIR99A)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407055 (MIR99A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407055 (MIR99A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407055
OMIM: 614509
HGNC: 31650
Ensembl: ENSG00000207638
miRBase: MI0000101
LinkDB All DBs
Position
21q21.1
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
aacccgtagatccgatcttgtg

DBGET integrated database retrieval system