KEGG   Homo sapiens (human): 442891Help
Entry
442891            miRNA     T01001                                 

Gene name
MIR135B, MIRN135B, mir-135b
Definition
(RefSeq) microRNA 135b
  KO
K17144  microRNA 135
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    442891 (MIR135B)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    442891 (MIR135B)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    442891 (MIR135B)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   442891 (MIR135B)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   442891 (MIR135B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 442891
HGNC: 31760
Ensembl: ENSG00000199059
miRBase: MI0000810
LinkDB All DBs
Position
1q32.1
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
tatggcttttcattcctatgtga

DBGET integrated database retrieval system