KEGG   Homo sapiens (human): 442900Help
Entry
442900            miRNA     T01001                                 

Gene name
MIR326, MIRN326, hsa-mir-326, mir-326
Definition
(RefSeq) microRNA 326
  KO
K17372  microRNA 326
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    442900 (MIR326)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    442900 (MIR326)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   442900 (MIR326)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 442900
OMIM: 613755
HGNC: 31769
Ensembl: ENSG00000199090
miRBase: MI0000808
LinkDB All DBs
Position
11q13.4
NT seq 20 nt NT seq  +upstreamnt  +downstreamnt
cctctgggcccttcctccag

DBGET integrated database retrieval system