KEGG   Homo sapiens (human): 494324Help
Entry
494324            miRNA     T01001                                 

Gene name
MIR375, MIRN375, hsa-mir-375, miRNA375, mir-375
Definition
(RefSeq) microRNA 375
  KO
K16976  microRNA 375
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    494324 (MIR375)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    494324 (MIR375)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   494324 (MIR375)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 494324
OMIM: 611173
HGNC: 31868
Ensembl: ENSG00000198973
miRBase: MI0000783
LinkDB All DBs
Position
2q35
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
gcgacgagcccctcgcacaaacc

DBGET integrated database retrieval system