KEGG   Homo sapiens (human): 494335Help
Entry
494335            miRNA     T01001                                 

Gene name
MIR423, MIRN423, hsa-mir-423, mir-423
Definition
(RefSeq) microRNA 423
  KO
K17376  microRNA 423
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    494335 (MIR423)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    494335 (MIR423)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   494335 (MIR423)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 494335
HGNC: 31880
Ensembl: ENSG00000283935
miRBase: MI0001445
LinkDB All DBs
Position
17q11.2
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
tgaggggcagagagcgagacttt

DBGET integrated database retrieval system