KEGG   Homo sapiens (human): 693187Help
Entry
693187            miRNA     T01001                                 

Gene name
MIR602, MIRN602, hsa-mir-602
Definition
(RefSeq) microRNA 602
  KO
K17379  microRNA 602
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    693187 (MIR602)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    693187 (MIR602)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   693187 (MIR602)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 693187
HGNC: 32858
Ensembl: ENSG00000207693
miRBase: MI0003615
LinkDB All DBs
Position
9q34.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
gacacgggcgacagctgcggccc

DBGET integrated database retrieval system