KEGG   Homo sapiens (human): 693200Help
Entry
693200            miRNA     T01001                                 

Gene name
MIR615, MIRN615, hsa-mir-615, mir-615
Definition
(RefSeq) microRNA 615
  KO
K17380  microRNA 615
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    693200 (MIR615)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    693200 (MIR615)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   693200 (MIR615)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 693200
HGNC: 32871
Ensembl: ENSG00000207571
miRBase: MI0003628
LinkDB All DBs
Position
12q13.13
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
gggggtccccggtgctcggatc

DBGET integrated database retrieval system