KEGG   Homo sapiens (human): 693210Help
Entry
693210            miRNA     T01001                                 

Gene name
MIR625, MIRN625, hsa-mir-625
Definition
(RefSeq) microRNA 625
  KO
K17381  microRNA 625
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    693210 (MIR625)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    693210 (MIR625)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   693210 (MIR625)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 693210
HGNC: 32881
Ensembl: ENSG00000207781
miRBase: MI0003639
LinkDB All DBs
Position
14q23.3
NT seq 21 nt NT seq  +upstreamnt  +downstreamnt
agggggaaagttctatagtcc

DBGET integrated database retrieval system