KEGG   Homo sapiens (human): 7031
Entry
7031              CDS       T01001                                 

Gene name
TFF1, BCEI, D21S21, HP1.A, HPS2, pNR-2, pS2
Definition
(RefSeq) trefoil factor 1
  KO
K22456  trefoil factor 1
Organism
hsa  Homo sapiens (human)
Pathway
hsa04915  Estrogen signaling pathway
Network
nt06227  Nuclear receptor signaling
nt06270  Breast cancer
nt06323  KISS1-GnRH-LH/FSH-E2 signaling
  Element
N00286  Nuclear-initiated estrogen signaling pathway
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09150 Organismal Systems
  09152 Endocrine system
   04915 Estrogen signaling pathway
    7031 (TFF1)
SSDB
Motif
Pfam: Trefoil
Other DBs
NCBI-GeneID: 7031
NCBI-ProteinID: NP_003216
OMIM: 113710
HGNC: 11755
Ensembl: ENSG00000160182
Vega: OTTHUMG00000086799
Pharos: P04155(Tbio)
UniProt: P04155
LinkDB
Structure
PDB: 
1HI7 1PS2

Position
21q22.3
AA seq 84 aa
MATMENKVICALVLVSMLALGTLAEAQTETCTVAPRERQNCGFPGVTPSQCANKGCCFDD
TVRGVPWCFYPNTIDVPPEEECEF
NT seq 255 nt   +upstreamnt  +downstreamnt
atggccaccatggagaacaaggtgatctgcgccctggtcctggtgtccatgctggccctc
ggcaccctggccgaggcccagacagagacgtgtacagtggccccccgtgaaagacagaat
tgtggttttcctggtgtcacgccctcccagtgtgcaaataagggctgctgtttcgacgac
accgttcgtggggtcccctggtgcttctatcctaataccatcgacgtccctccagaagag
gagtgtgaattttag

DBGET integrated database retrieval system