KEGG   Kibdelosporangium phytohabitans: AOZ06_33035Help
Entry
AOZ06_33035       gene      T04088                                 

Definition
(GenBank) pseudogene
Organism
kphy  Kibdelosporangium phytohabitans
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(7346747..7346926)
Genome map
NT seq 180 nt NT seq  +upstreamnt  +downstreamnt
tggcacaagtcttctcactcggccacccagggccagtgtgttgaggttggttctaccccg
gaccccactgtcatggcggttcgggacagcaagctgggcgatggcagcccgatcctgagg
ttctctcgcggcgggttcgccgccttcatcgacgacgtcaagcgcggcccgctggcctga

DBGET integrated database retrieval system