KEGG   Loxodonta africana (African savanna elephant): 100670448
Entry
100670448         CDS       T04351                                 

Gene name
BGLAP
Definition
(RefSeq) osteocalcin
  KO
K22609  osteocalcin
Organism
lav  Loxodonta africana (African savanna elephant)
Pathway
lav04928  Parathyroid hormone synthesis, secretion and action
Brite
KEGG Orthology (KO) [BR:lav00001]
 09150 Organismal Systems
  09152 Endocrine system
   04928 Parathyroid hormone synthesis, secretion and action
    100670448 (BGLAP)
SSDB
Other DBs
NCBI-GeneID: 100670448
NCBI-ProteinID: XP_003414987
LinkDB
Position
Unknown
AA seq 100 aa
MRPLTLLALLALAALCLAGQVDLKPSVADSGKGAAFVSKRESSEVVRRPRRYLDQVLGAP
APYPDPLELKKEVCELNPDCDELADHIGFHEAYRRFYGTV
NT seq 303 nt   +upstreamnt  +downstreamnt
atgagacccctcacactcttggccctgctggccctggccgcactctgcctcgctggccag
gtagatttgaagcccagcgttgctgactctggcaaaggtgcagccttcgtgtccaagcga
gagagcagtgaggtagtgaggagacccaggcgctacctggatcaagtgctgggagcccca
gccccctacccagatcccctggagctcaagaaggaggtgtgtgagctcaacccggactgt
gatgagctggctgaccacattggcttccacgaggcctatcggcgcttctatggcacggtc
tag

DBGET integrated database retrieval system