KEGG   Loxodonta africana (African savanna elephant): 100672824
Entry
100672824         CDS       T04351                                 

Gene name
GIP
Definition
(RefSeq) gastric inhibitory polypeptide
  KO
K05258  gastric inhibitory polypeptide
Organism
lav  Loxodonta africana (African savanna elephant)
Pathway
lav04024  cAMP signaling pathway
lav04080  Neuroactive ligand-receptor interaction
lav04911  Insulin secretion
Brite
KEGG Orthology (KO) [BR:lav00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04024 cAMP signaling pathway
    100672824 (GIP)
  09133 Signaling molecules and interaction
   04080 Neuroactive ligand-receptor interaction
    100672824 (GIP)
 09150 Organismal Systems
  09152 Endocrine system
   04911 Insulin secretion
    100672824 (GIP)
SSDB
Motif
Pfam: Hormone_2
Other DBs
NCBI-GeneID: 100672824
NCBI-ProteinID: XP_023409175
LinkDB
Position
Unknown
AA seq 88 aa
MDKIRQQDFVNWLLAQKGKKNDWKHNITQREARALELAVQSNRNEEAREKQSSLPKTPRD
EDLLRDLLIQELLAWMVDQMELCRLRFQ
NT seq 267 nt   +upstreamnt  +downstreamnt
atggacaagatccgccaacaagactttgtgaactggctgctggcccagaaggggaagaag
aatgactggaaacacaacatcacccagagggaggcccgggccctagagctggccgttcaa
tccaacaggaatgaggaggcaagggagaagcagagctccctacccaagacacccagggat
gaagatttgctaagggatttgctgattcaggagttgctggcctggatggtagatcagatg
gagctctgcaggctcaggtttcagtga

DBGET integrated database retrieval system