KEGG   Litoreibacter sp. LN3S51: FPZ52_12725Help
Entry
FPZ52_12725       gene      T06129                                 

Definition
(GenBank) pseudogene
Organism
lit  Litoreibacter sp. LN3S51
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
unnamed1:283844..284031
Genome map
NT seq 188 nt NT seq  +upstreamnt  +downstreamnt
atccgctaccatgaggccagtgatttcgatacgaatctcatcgctggagaagacacgagc
ggcgcaatcgacttggcccaggcgtgccgccggatcgatcagccaaaaggcgtgagcgcg
gattttccgccttgggcgtaacgcggcaatcgctgatcgggttgtggatcactgaacgcc
tcctgtga

DBGET integrated database retrieval system