KEGG   Meleagris gallopavo (turkey): 104914820
Entry
104914820         CDS       T01523                                 

Gene name
PMAIP1
Definition
(RefSeq) phorbol-12-myristate-13-acetate-induced protein 1
  KO
K10131  phorbol-12-myristate-13-acetate-induced protein 1
Organism
mgp  Meleagris gallopavo (turkey)
Pathway
mgp04115  p53 signaling pathway
mgp04210  Apoptosis
Brite
KEGG Orthology (KO) [BR:mgp00001]
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    104914820 (PMAIP1)
   04115 p53 signaling pathway
    104914820 (PMAIP1)
SSDB
Motif
Pfam: PMAIP1
Other DBs
NCBI-GeneID: 104914820
NCBI-ProteinID: XP_019465709
LinkDB
Position
Z
AA seq 89 aa
RAREGLIHAFPFSFSFFFFTFFFLSPISLSGKDLVRIKSPSPCACSAERDAVAECALELR
KIGDKADLQQKVLNLIAKLFCPKKPRPRC
NT seq 270 nt   +upstreamnt  +downstreamnt
agggcgagggaagggttgatacatgcttttcccttttccttttcctttttcttctttacc
ttcttctttctttccccgatatcgttatctggaaaagacctcgttagaattaaatcccca
tcgccctgcgcgtgttctgcagagcgggacgcggtggctgagtgcgcactggagctgcgc
aagatcggcgacaaggcggacctacagcagaaagtcctgaacctcatcgcgaaacttttc
tgccccaagaaaccgcgcccgcggtgctga

DBGET integrated database retrieval system