KEGG   Mycoplasma leachii PG50: MSB_A0896Help
Entry
MSB_A0896         CDS       T01367                                 

Definition
(GenBank) putative lipoprotein
Organism
mlc  Mycoplasma leachii PG50
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADR24547
UniProt: E4PSU0
LinkDB All DBs
Position
973621..974397
Genome map
AA seq 258 aa AA seqDB search
MKKVLTTLSVLSMITIPITITVSCSSWRTAPMTVKQISDVLDIYKNESLKQTNSDNVVVI
KASGLSNIDINSLQKIKENRENKLNKKIEENSKLIIDKLTEKISSVVSNKIINFETISSD
KTNLKDDIFSKQITKDFIKEKWKPYYLTISLADINFNSLVSKNKDQWLSKLNGLQTVTFR
NKDKSISINKTNKPKWFDTSINKVSIIDSLKLDSMLSSKTDTNLKINKIVYLVSFNANIL
SFKDAKNVAFYIEHDLNN
NT seq 777 nt NT seq  +upstreamnt  +downstreamnt
gtgaaaaaagtcttaactacattaagtgttttaagtatgataactatacctataacaata
acagtttcttgttcatcatgaagaacagcaccaatgacagttaaacaaatttcagatgtt
ttagatatttataaaaatgaatctttaaaacaaacaaattctgataatgttgtagtaatt
aaagccagtggtctttctaatatagacataaactctttacaaaaaatcaaagaaaacaga
gaaaataaattaaataagaaaattgaagaaaattcaaaacttattatagataaattaaca
gaaaaaatatcatctgttgtttcaaataaaataattaattttgaaactattagttctgat
aaaactaatctaaaagacgatattttttcaaaacaaataacaaaagattttattaaagaa
aaatgaaaaccatattatcttactattagtttagctgatattaatttcaattctttagtt
tctaaaaataaagatcaatgattatctaaattaaatggtttacaaactgttacttttaga
aataaagataaatctatttctattaataaaacaaataaacctaaatgatttgatactagt
ataaacaaagtatctattatagattcactaaaattagactctatgttatcttcaaaaact
gatacaaatttaaaaataaataaaattgtttatttagtatcatttaatgctaatatttta
agttttaaagatgcaaaaaacgtagctttttatattgaacacgatttaaataactag

DBGET integrated database retrieval system