KEGG   Methylomonas methanica: Metme_R0015Help
Entry
Metme_R0015       ncRNA     T01511                                 

Definition
(GenBank) 6S RNA
Organism
mmt  Methylomonas methanica
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(829953..830132)
Genome map
NT seq 180 nt NT seq  +upstreamnt  +downstreamnt
tatctcctgcagcgttcgagcaatgctgggtgtttcctgaacctgtttttaccccggaaa
ctttttgccagtcatggtgcgcatgcctgtttattcaggaagcctgattgactggatttg
gtttccacttgaaccttcggttcaaggacgaaagcatgagacggcgcaggcgggagatct

DBGET integrated database retrieval system