KEGG   Mus musculus (mouse): 21748Help
Entry
21748             ncRNA     T01002                                 

Gene name
Terc, mTER, mTR
Definition
(RefSeq) telomerase RNA component
  KO
K22183  telomerase RNA component
Organism
mmu  Mus musculus (mouse)
Pathway
mmu05200  Pathways in cancer
mmu05225  Hepatocellular carcinoma
mmu05226  Gastric cancer
Brite
KEGG Orthology (KO) [BR:mmu00001]
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    21748 (Terc)
  09162 Cancer: specific types
   05225 Hepatocellular carcinoma
    21748 (Terc)
   05226 Gastric cancer
    21748 (Terc)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:mmu03100]
    21748 (Terc)
Non-coding RNAs [BR:mmu03100]
 Other RNA
  Unclassified
   21748 (Terc)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 21748
MGI: 109558
Ensembl: ENSMUSG00000118406
LinkDB All DBs
Position
3; 3 F2.1
NT seq 397 nt NT seq  +upstreamnt  +downstreamnt
acctaaccctgattttcattagctgtgggttctggtcttttgttctccgcccgctgtttt
tctcgctgacttccagcgggccaggaaagtccagacctgcagcgggccaccgcgcgttcc
cgagcctcaaaaacaaacgtcagcgcaggagctccaggttcgccgggagctccgcggcgc
cgggccgcccagtcccgtacccgcctacaggccgcggccggcctggggtcttaggactcc
gctgccgccgcgaagagctcgcctctgtcagccgcggggcgccgggggctggggccaggc
cgggcgagcgccgcgaggacaggaatggaactggtccccgtgttcggtgtcttacctgag
ctgtgggaagtgcacccggaactcggttctcacaacc

DBGET integrated database retrieval system