KEGG   Mycobacterium tuberculosis Haarlem/NITR202: I917_t27688Help
Entry
I917_t27688       tRNA      T02654                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
mtuh  Mycobacterium tuberculosis Haarlem/NITR202
Pathway
mtuh00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:mtuh00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    I917_t27688
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:mtuh03100]
    I917_t27688
Non-coding RNAs [BR:mtuh03100]
 Transfer RNA
  tRNA
   I917_t27688
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(4209778..4209866)
Genome map
NT seq 89 nt NT seq  +upstreamnt  +downstreamnt
ggaggcgtgccagagcggccgaatggggctcactgctaatgagttgtcccccttcaaggg
gaccggaggttcaaatcctctcgcctccg

DBGET integrated database retrieval system