KEGG   Nitrincola sp. KXZD1103: F5I99_10090
Entry
F5I99_10090       CDS       T06212                                 

Gene name
dmpH
Definition
(GenBank) 2-oxo-3-hexenedioate decarboxylase
  KO
K01617  2-oxo-3-hexenedioate decarboxylase [EC:4.1.1.77]
Organism
nik  Nitrincola sp. KXZD1103
Pathway
nik00362  Benzoate degradation
nik00621  Dioxin degradation
nik00622  Xylene degradation
nik01100  Metabolic pathways
nik01120  Microbial metabolism in diverse environments
nik01220  Degradation of aromatic compounds
Module
nik_M00569  Catechol meta-cleavage, catechol => acetyl-CoA / 4-methylcatechol => propanoyl-CoA
Brite
KEGG Orthology (KO) [BR:nik00001]
 09100 Metabolism
  09111 Xenobiotics biodegradation and metabolism
   00362 Benzoate degradation
    F5I99_10090 (dmpH)
   00622 Xylene degradation
    F5I99_10090 (dmpH)
   00621 Dioxin degradation
    F5I99_10090 (dmpH)
Enzymes [BR:nik01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.77  2-oxo-3-hexenedioate decarboxylase
     F5I99_10090 (dmpH)
SSDB
Other DBs
NCBI-ProteinID: QEW06824
UniProt: A0A5J6LDN9
LinkDB
Position
complement(2195369..2196160)
AA seq 263 aa
MGNLTRTEIEQLATYCEDAELQAYEITKVTDQYPQMTYEDAFDVQWEVRKRKEARGHKIV
GMKMGLTSWAKMAQMGVEQPCYGYLADYFSVPEGGEIKMDELIHPKIEAEIAFVTKAPLK
GPGVHIGDVMRATDFIIPAVEVIDSRYKDFKFDLKSVIADNSSSTRFITGGRMARLEDVD
VTTLGVVMEINGEVVATGAGAAVLGHPAASVAMLANMLGERGEEIPAGTFIMTGGITAAV
TVNRGDSITVRYQNLGSISAKFI
NT seq 792 nt   +upstreamnt  +downstreamnt
atgggtaatttaacacgtacagaaatcgagcaactggcaacctattgtgaagacgctgag
ctacaggcttatgaaatcaccaaggtcactgatcagtacccgcagatgacctacgaagac
gcgtttgatgtgcagtgggaggtgcgcaagcgcaaagaggcgcgtggtcacaagattgtg
ggtatgaaaatgggcctgacctcctgggcaaaaatggcgcagatgggggtagagcaaccc
tgttatggctatctggccgattatttcagtgtgcctgagggtggcgagatcaaaatggat
gaattgattcatccgaaaattgaagccgaaattgcctttgtcaccaaagccccattgaaa
ggcccaggcgtgcatattggtgatgtgatgcgcgcgaccgacttcatcatcccggcggtg
gaagtgattgactcccgctacaaggatttcaagttcgaccttaaaagcgtgatcgccgat
aactccagttcaacacgttttattaccggtgggcgcatggcgcgtctggaagatgtagac
gtgacaacactgggtgtggtgatggagatcaatggtgaggtagtcgccacgggagccggt
gccgcggtgctgggtcatccggccgcctcggtagcgatgctggcaaatatgctcggtgag
cggggtgaagagataccggctggtaccttcattatgaccggtggaatcactgcggccgtc
accgtgaaccggggtgattccattaccgttcgttatcagaatcttggatctatatcggct
aagtttatttaa

DBGET integrated database retrieval system