Ornithorhynchus anatinus (platypus): 100314636 Help Entry 100314636         miRNA     T01045                                  Symbol MIR20A-1 Name (RefSeq) oan-miR-20a-5p   KO K17006   microRNA 20a Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:oaa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100314636 (MIR20A-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oaa04147]     100314636 (MIR20A-1)   09184 RNA family    03100 Non-coding RNAs [BR:oaa03100]     100314636 (MIR20A-1) Exosome [BR:oaa04147]  Exosomal RNA   Exosomal RNA of breast milk    100314636 (MIR20A-1)   Exosomal RNA of other cancer cells    100314636 (MIR20A-1) Non-coding RNAs [BR:oaa03100]  Small non-coding RNA   Micro RNA    100314636 (MIR20A-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314636 miRBase:  MI0006872 LinkDB All DBs Position 10:complement(29148030..29148165) Genome browser NT seq 20 nt NT seq  +upstreamnt  +downstreamnt taaagtgcttatagtgcagg

DBGET integrated database retrieval system