Pseudomonas aeruginosa SCV20265: SCV20265_3528 Help Entry SCV20265_3528     CDS       T02971                                  Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism paes  Pseudomonas aeruginosa SCV20265 Pathway paes01100   Metabolic pathways paes01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paes00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SCV20265_3528   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SCV20265_3528 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  AHC77640 LinkDB All DBs Position complement(3778811..3779050) Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALETEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggtg gttgaactggtcatggccctggaaacggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system