KEGG   Paraburkholderia aromaticivorans: CJU94_38130
Entry
CJU94_38130       CDS       T05169                                 

Gene name
dmpH
Definition
(GenBank) 2-oxo-3-hexenedioate decarboxylase
  KO
K01617  2-oxo-3-hexenedioate decarboxylase [EC:4.1.1.77]
Organism
parb  Paraburkholderia aromaticivorans
Pathway
parb00362  Benzoate degradation
parb00621  Dioxin degradation
parb00622  Xylene degradation
parb01100  Metabolic pathways
parb01120  Microbial metabolism in diverse environments
parb01220  Degradation of aromatic compounds
Module
parb_M00569  Catechol meta-cleavage, catechol => acetyl-CoA / 4-methylcatechol => propanoyl-CoA
Brite
KEGG Orthology (KO) [BR:parb00001]
 09100 Metabolism
  09111 Xenobiotics biodegradation and metabolism
   00362 Benzoate degradation
    CJU94_38130 (dmpH)
   00622 Xylene degradation
    CJU94_38130 (dmpH)
   00621 Dioxin degradation
    CJU94_38130 (dmpH)
Enzymes [BR:parb01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.77  2-oxo-3-hexenedioate decarboxylase
     CJU94_38130 (dmpH)
SSDB
Other DBs
NCBI-ProteinID: ASW03970
UniProt: A0A248W013
LinkDB
Position
pBN2:380923..381711
AA seq 262 aa
MKLDRTTIARLAEHLENCELHAQDTLKITDEHPEMDWDDAYAIQDEIRRRKLARGGKIVG
LKAGLTSHAKMKQMGVESPVFGFMADYYAIPDGGTCKTEALIHPKVEPEIAFVTKAPLKG
PGCHIGAVLAATDFVMPGIEVIDSRYRDFKFDLKSVVADNTSAARFVVGGRALPVSEVDL
RTVGIVLEKNGEPVAFGAGAAVLGHPAAAIAMLANHLGARGEEIPAGSLILSGGITEAIA
VRAGDAIALRVQGMGGTGLRFV
NT seq 789 nt   +upstreamnt  +downstreamnt
atgaaactggatcgcaccaccattgcgcgccttgcagagcacctcgagaactgcgagctc
cacgcgcaagacacgctcaagatcaccgatgagcatcccgagatggattgggatgacgct
tacgcgatccaggacgagattcgccgccgcaagctggcccgcggcgggaagatcgttggg
ctcaaagcggggctgacctcgcacgccaaaatgaagcagatgggggttgagagccctgtc
ttcggcttcatggccgactattacgcgatccccgatggcggcacgtgcaagaccgaggcg
ctgatccatcccaaggtcgagccggaaatcgcctttgttaccaaagcgccgttgaaaggc
ccgggctgtcatattggagcggtgctggcggcgactgacttcgtgatgccgggcatcgaa
gtcattgactcgcgctaccgcgatttcaagttcgatctcaaaagtgtggtagcggacaac
acgtcggccgcacgctttgtggtgggtgggcgcgcactgccagtgtctgaggtggatctg
cgcaccgtcggcatcgtgctggagaaaaacggtgagccggttgcgttcggggcgggcgcc
gcggtgctgggccacccggccgcggcgattgcgatgctggccaatcatctgggcgcgcgt
ggcgaggagattccggcgggcagtttgattctgtcaggggggatcacggaggccattgcc
gtgcgagcgggggatgccatcgccctgcgggtgcaggggatgggcggcaccggtttgcgc
ttcgtttaa

DBGET integrated database retrieval system