Paenibacillus polymyxa E681: PPE_01850 Help Entry PPE_01850         CDS       T01319                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ppy  Paenibacillus polymyxa E681 Pathway ppy00998   Biosynthesis of various antibiotics ppy01100   Metabolic pathways ppy01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ppy00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PPE_01850   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PPE_01850 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF1493 Motif Other DBs NCBI-ProteinID:  ADM69686 UniProt:  E0RG92 LinkDB All DBs Position 1970565..1970798 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatcttttaaagatgatttaggcgctgattctctcgatgta gttgaattagtaatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaactgtaggtgaagttgtgaagtacatacaatctcatacctaa

DBGET integrated database retrieval system