KEGG   Phreatobacter stygius: E8M01_32880Help
Entry
E8M01_32880       CDS       T05955                                 

Gene name
secG
Definition
(GenBank) preprotein translocase subunit SecG
  KO
K03075  preprotein translocase subunit SecG
Organism
pstg  Phreatobacter stygius
Pathway
pstg02024  Quorum sensing
pstg03060  Protein export
pstg03070  Bacterial secretion system
Brite
KEGG Orthology (KO) [BR:pstg00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    E8M01_32880 (secG)
 09130 Environmental Information Processing
  09131 Membrane transport
   03070 Bacterial secretion system
    E8M01_32880 (secG)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    E8M01_32880 (secG)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   02044 Secretion system [BR:pstg02044]
    E8M01_32880 (secG)
Secretion system [BR:pstg02044]
 Sec (secretion) system
  Prokaryotic Sec-SRP core components
   E8M01_32880 (secG)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: SecG
Motif
Other DBs
NCBI-ProteinID: QCI68607
UniProt: A0A4D7BLL3
LinkDB All DBs
Position
complement(6961690..6962133)
Genome map
AA seq 147 aa AA seqDB search
MQTVILVVHLMIVIALIIVVLLQRSEGGGLGMGGGGNFMSSRGTANVLTRATAILAAAFF
FTSIVLALLATQARGPRSILEQGTAPAAPSAPAVPGAPAAPQVPPSGQGGGTGVLEGLRG
LSQPPAAPGGSQPPAAPGSQPPAAPSR
NT seq 444 nt NT seq  +upstreamnt  +downstreamnt
atgcagaccgtcattctcgtcgtccatctgatgatcgtgattgcactgatcatcgttgtt
ctgttgcagcgctccgaaggcggtggcctcggcatgggcggcggcggcaatttcatgtcg
tcgcgcggcacggccaatgtgttgaccagggcgaccgccattctggcggcggccttcttc
ttcacctcgatcgtgctggctctgcttgccacccaggcccgcgggccgcgctccatcctg
gaacagggcacggcaccggcggctccatccgctcccgcggtgcccggcgcgccggcagct
ccgcaggttccgccgtcggggcagggtggtggcacgggcgtgctcgaagggcttcgcggc
ctgtcgcagccgccggccgcaccggggggttcgcagcccccggcagcgcccggttcgcag
ccgccggccgcgccctcgcggtaa

DBGET integrated database retrieval system