KEGG   Paenibacillus terrae: HPL003_t28056Help
Entry
HPL003_t28056     tRNA      T01668                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
pta  Paenibacillus terrae
Pathway
pta00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pta00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPL003_t28056
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pta03100]
    HPL003_t28056
Non-coding RNAs [BR:pta03100]
 Transfer RNA
  HPL003_t28056
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(753277..753347)
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
gcgggtgtagttcaatggtagaacttcagccttccaagctgatagcgtgggttcgattcc
catcacccgct

DBGET integrated database retrieval system