KEGG   Paenibacillus terrae: HPL003_t28114Help
Entry
HPL003_t28114     tRNA      T01668                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
pta  Paenibacillus terrae
Pathway
pta00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pta00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HPL003_t28114
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pta03100]
    HPL003_t28114
Non-coding RNAs [BR:pta03100]
 Transfer RNA
  HPL003_t28114
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
2064435..2064510
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tccctgatagctcagttggtagagcactcgactgttaatcgagttgtcacaggttcgagt
cctgttcggggagcca

DBGET integrated database retrieval system