KEGG   Panthera tigris altaica (Amur tiger): 102955464
Entry
102955464         CDS       T02988                                 

Gene name
BBC3
Definition
(RefSeq) BCL2 binding component 3
  KO
K10132  Bcl-2-binding component 3
Organism
ptg  Panthera tigris altaica (Amur tiger)
Pathway
ptg01524  Platinum drug resistance
ptg04115  p53 signaling pathway
ptg04210  Apoptosis
ptg04215  Apoptosis - multiple species
ptg04390  Hippo signaling pathway
ptg05016  Huntington disease
ptg05162  Measles
ptg05200  Pathways in cancer
ptg05210  Colorectal cancer
Brite
KEGG Orthology (KO) [BR:ptg00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04390 Hippo signaling pathway
    102955464 (BBC3)
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    102955464 (BBC3)
   04215 Apoptosis - multiple species
    102955464 (BBC3)
   04115 p53 signaling pathway
    102955464 (BBC3)
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    102955464 (BBC3)
  09162 Cancer: specific types
   05210 Colorectal cancer
    102955464 (BBC3)
  09164 Neurodegenerative disease
   05016 Huntington disease
    102955464 (BBC3)
  09172 Infectious disease: viral
   05162 Measles
    102955464 (BBC3)
  09176 Drug resistance: antineoplastic
   01524 Platinum drug resistance
    102955464 (BBC3)
SSDB
Other DBs
NCBI-GeneID: 102955464
NCBI-ProteinID: XP_007099200
LinkDB
Position
Un
AA seq 119 aa
MDRNNAQIHPSHPYTARQDVLCAGAARACPRQVPGASXLPWVPRQICETRGAAATPPLTL
EGPVQSHHGTPALTQGPRGPGDGAQLGACTRPVDVGDLGGRTLPPPDALASAGDFFCTM
NT seq 360 nt   +upstreamnt  +downstreamnt
atggaccgcaacaacgcacagatacacccgtcacacccgtacacagcacgccaggacgtc
ctgtgtgcaggggctgcccgggcatgtccccgtcaggtgcctggggcttccnttcttccc
tgggtgccccgtcagatttgtgagacaagaggagcagcagcgacaccgcccctcaccctg
gagggtcctgtacaatctcatcatgggactcctgcccttacccagggcccgcggggcccc
ggagatggagcccaattaggtgcctgcacccgcccggtggacgtcggggacttggggggc
aggaccctcccacctcctgatgccctggccagcgcgggggactttttctgcaccatgtag

DBGET integrated database retrieval system