KEGG   Rhodococcus opacus PD630: Pd630_LPD03452
Entry
Pd630_LPD03452    CDS       T03071                                 

Definition
(GenBank) Deoxyuridine 5'-triphosphate nucleotidohydrolase
  KO
K01520  dUTP pyrophosphatase [EC:3.6.1.23]
Organism
roa  Rhodococcus opacus PD630
Pathway
roa00240  Pyrimidine metabolism
roa01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:roa00001]
 09100 Metabolism
  09104 Nucleotide metabolism
   00240 Pyrimidine metabolism
    Pd630_LPD03452
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03400 DNA repair and recombination proteins [BR:roa03400]
    Pd630_LPD03452
Enzymes [BR:roa01000]
 3. Hydrolases
  3.6  Acting on acid anhydrides
   3.6.1  In phosphorus-containing anhydrides
    3.6.1.23  dUTP diphosphatase
     Pd630_LPD03452
DNA repair and recombination proteins [BR:roa03400]
 Eukaryotic type
  Other factors with a suspected DNA repair function
   Modulation of nucleotide pools
    Pd630_LPD03452
 Prokaryotic type
    Pd630_LPD03452
SSDB
Motif
Pfam: dUTPase
Other DBs
NCBI-ProteinID: AHK30671
LinkDB
Position
3651149..3651670
AA seq 173 aa
MHVSDLSPGLSPAATPALPPVALQRLDPDIPVPQRAHDGDAGVDLCSTIDVTIEPGRRVL
VGTGIAIALPLGTVGLIHPRSGLAAKSGLSVVNTPGTIDAGYRGEIKVCLINHDLETPIE
IRRGDRIAQLLVQRVELVSFVEVPSLDGTTRGSDGHGSSGGHASLVGNASEGA
NT seq 522 nt   +upstreamnt  +downstreamnt
gtgcacgtgagcgacctatctcccggcctttctcccgccgcgacccccgcccttccgccc
gtcgccctccagcggctggaccccgacattccggtcccgcagcgtgcgcacgacggcgac
gccggtgtcgacctgtgcagcaccatcgacgtgaccatcgagccggggcgccgcgtcctc
gtcggaaccggcatcgcgatcgcgctgcccctgggcacggtcgggctgatccatccccga
tccgggctggccgcaaaatcgggtctgtcggtggtcaacacccccggcaccatcgatgcc
gggtaccgcggcgagatcaaggtgtgcctgatcaatcacgacctcgagaccccgatcgag
atccgccggggcgaccggatcgcccaactgctcgtccagcgggtcgaactggtgtcgttc
gtcgaggtcccgtcgctcgacggcaccacccgcggcagcgacggccacgggtcgagcgga
ggccacgcgagcctcgtcggcaatgccagtgaaggagcctga

DBGET integrated database retrieval system