Pararhodospirillum photometricum: RSPPHO_02819 Help Entry RSPPHO_02819      CDS       T01851                                  Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism rpm  Pararhodospirillum photometricum Pathway rpm01100   Metabolic pathways rpm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:rpm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RSPPHO_02819   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RSPPHO_02819 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  CCG09445 UniProt:  H6SPC0 LinkDB All DBs Position complement(3378700..3378951) Genome browser AA seq 83 aa AA seqDB search MSDIENKIYDIIVEKTAVERDRLSRDARLGDLSISSLDFVEIVFAVEETFDIEVPYNANT QDQDFKTLGDIVAAVEALVAARD NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgagtgacattgaaaacaagatctacgatattatcgtcgaaaagacggcggtggagcgc gaccgtctgagccgggatgctcgcctgggagacctcagcatttcctctctcgattttgtc gagatcgtttttgcggttgaggaaaccttcgatatcgaggtcccgtataacgccaatacc caggatcaagacttcaagaccctcggcgacattgttgccgccgttgaggccctggtcgcc gcgcgcgattag

DBGET integrated database retrieval system