KEGG   Streptococcus pneumoniae 670-6B: SP670_0869Help
Entry
SP670_0869        CDS       T01308                                 

Definition
(GenBank) restriction endonuclease R.XbaI
Organism
snb  Streptococcus pneumoniae 670-6B
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: RE_ApaLI
Motif
Other DBs
NCBI-ProteinID: ADM90934
LinkDB All DBs
Position
complement(804973..805155)
Genome map
AA seq 60 aa AA seqDB search
MANDNKSHYLIYRVLGISFEEGENIDLYQNKGRFLYKYAGSFLEEAAVLSFNEKFGTENT
NT seq 183 nt NT seq  +upstreamnt  +downstreamnt
atggcaaatgataataagagccattatttgatatacagagttttaggtatttcatttgaa
gaaggagaaaatatcgatttgtatcaaaataaaggtcgttttttatacaaatatgctggt
tcatttttagaagaagctgcagtactatcctttaacgaaaaatttggtacagaaaatact
taa

DBGET integrated database retrieval system