KEGG   Streptomyces pluripotens: LK06_021910Help
Entry
LK06_021910       CDS       T04845                                 

Definition
(GenBank) heavy metal transporter
Organism
splu  Streptomyces pluripotens
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ARP74355
UniProt: A0A221P938
LinkDB All DBs
Position
complement(4865954..4866877)
Genome map
AA seq 307 aa AA seqDB search
MVLCGIAAYLVVQYVTGGGARGCKVVSASGGATSYEFTPEQAVNAATIAAVGTEHDMPER
AVTIALATALQESGLRNIEHGDRDSLGLFQQRPSQGWGTERQIMDPSYAAGMFYAHLAKV
PDYTDLPLTVAAQRVQRSGYPEAYAKHEVDASLLAAALTGRAAATLTCDGRPARTASATG
PDAVRAALVRDFGRDALREAGAQVGGTPVPAPTPAPSVTSTARGRTVTVPVPEGAKADAT
GRTERERGWQLAHWAVANSSALHIERVSYAGREWSAGRGADRWGPVGPADAGGAQESTGA
VRIVTGQ
NT seq 924 nt NT seq  +upstreamnt  +downstreamnt
ttggtcctgtgcggcatcgccgcgtacctcgtggtgcagtacgtcaccggcggcggcgca
cgcggctgcaaggtggtgtcagcctcgggcggcgcgacatcgtacgagttcacaccggag
caggcagtgaacgcggcgacgatcgccgccgtcggcaccgagcacgacatgcccgagcgg
gccgtgacgatcgcgctggcgactgccctgcaggagtcgggcctgcgcaacatcgaacac
ggcgaccgggattcgctggggctgttccagcaacggccatcgcagggctggggcaccgag
cggcagatcatggatccgtcgtacgcggcgggcatgttctatgcgcacctggccaaggtg
ccggactacacggatctgccactgacggtggccgcgcaacgggtgcagcgcagcggctat
ccggaggcgtacgcgaagcacgaggtggacgcctcgctgctggccgcggcgctgaccggg
cgcgcggcggccacgctgacctgtgacgggcgcccggcacgcacggcctcggcgaccggt
ccggacgcagtacgggcggcgctggtaagggacttcggacgggacgcgctgcgggaggcc
ggtgcgcaggtgggcggtacgcccgtgccggcgccgacccccgcgccgagcgtgacctcg
accgcgcgcgggcggaccgtgaccgtcccggtgcccgagggcgcgaaggccgacgccacc
ggacgcaccgaacgggagcggggctggcagctggcgcactgggcggtcgccaactcctcg
gcgctgcacatcgagcgggtctcgtatgcaggacgggagtggagcgcgggccgtggtgcc
gaccggtgggggccggttggcccggcggacgccggtggtgcgcaggagtccaccggggcg
gtcaggatcgtgaccggacagtag

DBGET integrated database retrieval system