KEGG   Streptococcus pneumoniae gamPNI0373 (virulent serotype 1): HMPREF1038_01416Help
Entry
HMPREF1038_01416  CDS       T02334                                 

Definition
(GenBank) putative type II restriction endonuclease, truncation
Organism
spng  Streptococcus pneumoniae gamPNI0373 (virulent serotype 1)
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: RE_ApaLI
Motif
Other DBs
NCBI-ProteinID: AFS43448
LinkDB All DBs
Position
1308794..1308976
Genome map
AA seq 60 aa AA seqDB search
MANDNKSHYLIYRVLGISFEEGENIDLYQNKGRFLYKYAGSFLEEAAVLSFNEKFGTENT
NT seq 183 nt NT seq  +upstreamnt  +downstreamnt
atggcaaatgataataagagccattatttgatatacagagttttaggtatttcatttgaa
gaaggagaaaatatcgatttgtatcaaaataaaggtcgttttttatacaaatatgctggt
tcatttttagaagaagctgcagtactatcctttaacgaaaaatttggtacagaaaatact
taa

DBGET integrated database retrieval system