Thermomonas brevis: H9L17_04635 Help Entry H9L17_04635       CDS       T06816                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism tbv  Thermomonas brevis Brite KEGG Orthology (KO) [BR:tbv00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:tbv03032]     H9L17_04635    03036 Chromosome and associated proteins [BR:tbv03036]     H9L17_04635    03400 DNA repair and recombination proteins [BR:tbv03400]     H9L17_04635 DNA replication proteins [BR:tbv03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     H9L17_04635 Chromosome and associated proteins [BR:tbv03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     H9L17_04635 DNA repair and recombination proteins [BR:tbv03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       H9L17_04635 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 HU-DNA_bdg DUF2267 HU-CCDC81_euk_1 DUF2190 Peptidase_M35 Chalcone_3 HU-CCDC81_bac_1 Motif Other DBs NCBI-ProteinID:  QNN47434 UniProt:  A0A7G9QVQ9 LinkDB All DBs Position complement(993463..993735) Genome browser AA seq 90 aa AA seqDB search MNKAEFVEAVADNAELTKADAGRAVDAMVAAITKALKKGDTVTLVGFGTFSVRKRGARTG RNPRTGDTIKIKASKNPAFKAGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaaagccgaattcgtcgaagccgtggccgacaacgccgaactgaccaaggccgat gccggccgcgccgtcgatgcgatggtcgccgccatcaccaaggccctgaagaagggcgac accgtgaccctcgtgggcttcggcaccttctcggtccgcaagcgtggcgcccgcaccggc cgcaacccgcgcaccggcgacaccatcaagatcaaggcttccaagaacccggcgttcaag gccggcaaggcgctgaaggacgcggtcaactga

DBGET integrated database retrieval system