KEGG   Tenacibaculum jejuense: TJEJU_2929
Entry
TJEJU_2929        CDS       T05041                                 

Gene name
cgiA
Definition
(GenBank) Probable lipoprotein precursor. Putative glycoside hydrolase family 82, iota-carrageenase
  KO
K20850  iota-carrageenase [EC:3.2.1.157]
Organism
tje  Tenacibaculum jejuense
Brite
KEGG Orthology (KO) [BR:tje00001]
 09190 Not Included in Pathway or Brite
  09191 Unclassified: metabolism
   99980 Enzymes with EC numbers
    TJEJU_2929 (cgiA)
Enzymes [BR:tje01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.157  iota-carrageenase
     TJEJU_2929 (cgiA)
SSDB
Other DBs
NCBI-ProteinID: SNR16598
UniProt: A0A238UDD5
LinkDB
Position
TJEJU:complement(3263097..3264650)
AA seq 517 aa
MIFKNFFLAAVTLTAVITTSCSDNVENLEAVNGSVDTELELANRLPQKFKPSQFYTAPTG
TTRVSFTGTTTNDLNRLINQQSDENGSGVIIEIPKSTYYWNKVVLKSNIHLEIAGGTKII
LDGTKGGVFSIGGSKNGNRLKNVSISGKNGAKFTVDISSPSLTNQNINVLKIGRVDNFRF
ADINIKDRRSSVNSIVLVHVPGSPERRPGPVDGVIENIHQTGAHTGYGLVQTYNAQHVLF
NKLSCDGGITLRMETDDKGMKNELKDGVKEGGIADIFAFDVKNTNGLCAVMFSPHFVQNG
KVTVQKVRATGSAFAVRVEKGFLELFDKAKRFPMNDNGKERFRKFVERQFRGLSGSALSG
NPYKRNNGTQWATRLTPEASAAPRNRYVSDQLGSGLIAGSFQSSRITGVTAVSQNDGGAK
IKQAHLKFIPCNLWNKIKNPAKSLGMFDGFEYHGPSISLSYDNTNGSTVGGHYNVTLVNE
NFRNFAAGSIQNIKYNTNATCNKKPATITKYSANFPN
NT seq 1554 nt   +upstreamnt  +downstreamnt
atgatttttaagaatttttttttagcagctgtaaccttaacagctgtaattacaacgtct
tgttcagataatgtagaaaatttagaagctgtaaatggaagtgtagacacagaattagag
cttgctaatcgcttacctcaaaaatttaaaccatctcaattttacactgccccaacagga
acaacaagagtttcgtttactggaactactacaaatgatttgaatcgtttaattaatcaa
caatcagatgaaaatggctcaggtgtaattattgaaattccaaagtcaacatattactgg
aataaagttgttttaaagtctaacattcatttagaaattgctggaggaactaaaattatt
ttagatggtacaaaaggaggcgtattttctattggaggaagtaaaaacggaaatcgttta
aaaaatgtaagtattagtggtaaaaatggagctaagtttacagtagatatttcttctcct
tcattaactaatcaaaatatcaatgtacttaaaattggacgtgttgataattttagattt
gctgatatcaatattaaagatagaagaagttctgtaaactctattgtattagttcacgtt
ccaggatcaccagaaagaagaccaggacctgtagatggtgttattgaaaacatacaccaa
accggtgcgcatacaggatatggacttgtacaaacgtacaacgcacaacatgttttattc
aataaactttcttgtgatggaggaattacattacgaatggaaacagatgataaaggaatg
aaaaatgaattgaaagatggtgtaaaagaaggaggaattgcagatatttttgcctttgat
gtaaaaaacaccaatggattatgtgcggtaatgttttctccacattttgtgcagaatgga
aaagttactgtacaaaaagtaagagcaacaggctcagcttttgcagtaagagtagaaaaa
ggatttttagagttatttgataaagctaaaagatttcctatgaatgataatggaaaagaa
cgatttagaaaatttgtagaaagacaatttagaggattatctggatcagcattatcagga
aatccatacaagagaaataatggtacacaatgggctactagattaacgccagaagcaagt
gcagcaccaagaaatagatatgtttcagatcaactaggtagtggactaatagcaggaagt
tttcaaagttcacgaataacaggtgtaacagcagtaagtcaaaatgatggtggagctaaa
atcaagcaagcacacttaaaatttattccatgtaacttatggaataaaattaaaaaccct
gcaaaaagtttaggaatgtttgatggttttgaatatcatggtccatcaatatcgctaagt
tatgacaatacaaacggaagtacagttggtggtcattataatgtaactttagttaatgaa
aactttaggaatttcgcagcaggttcaattcaaaatataaagtacaataccaacgctact
tgtaacaaaaaaccagctactataactaaatattcagctaattttccaaactaa

DBGET integrated database retrieval system