KEGG   Ursus maritimus (polar bear): 103657211
Entry
103657211         CDS       T03271                                 

Gene name
BBC3
Definition
(RefSeq) BCL2 binding component 3
  KO
K10132  Bcl-2-binding component 3
Organism
umr  Ursus maritimus (polar bear)
Pathway
umr01524  Platinum drug resistance
umr04115  p53 signaling pathway
umr04210  Apoptosis
umr04215  Apoptosis - multiple species
umr04390  Hippo signaling pathway
umr05016  Huntington disease
umr05162  Measles
umr05200  Pathways in cancer
umr05210  Colorectal cancer
Brite
KEGG Orthology (KO) [BR:umr00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04390 Hippo signaling pathway
    103657211 (BBC3)
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    103657211 (BBC3)
   04215 Apoptosis - multiple species
    103657211 (BBC3)
   04115 p53 signaling pathway
    103657211 (BBC3)
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    103657211 (BBC3)
  09162 Cancer: specific types
   05210 Colorectal cancer
    103657211 (BBC3)
  09164 Neurodegenerative disease
   05016 Huntington disease
    103657211 (BBC3)
  09172 Infectious disease: viral
   05162 Measles
    103657211 (BBC3)
  09176 Drug resistance: antineoplastic
   01524 Platinum drug resistance
    103657211 (BBC3)
SSDB
Other DBs
NCBI-GeneID: 103657211
NCBI-ProteinID: XP_008682858
UniProt: A0A384BJS6
LinkDB
Position
Un
AA seq 90 aa
PPLSPWQAHSNFLLSLSLETRGAAATPPLTLEGPVQSHHGTPAVTQGPRSPGDGAQLGAC
TRPVDIRDLGGRTLPPPDALASAGDFFCTM
NT seq 273 nt   +upstreamnt  +downstreamnt
ccacccctgtccccgtggcaagcccactctaacttcctcctttccctctccctagagaca
agaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatggg
actcctgccgttacccaggggccgcggagccccggagatggagcccaattaggtgcctgc
acccgcccggtggacatcagggacttggggggcaggaccctcccacctcctgatgccctg
gccagcgcgggggactttttctgcaccatgtag

DBGET integrated database retrieval system