KEGG   Vibrio anguillarum NB10: VANGNB10_cII0479cHelp
Entry
VANGNB10_cII0479c gene      T03657                                 

Definition
(GenBank) pseudogene
Organism
vau  Vibrio anguillarum NB10
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
2:complement(join(538647..538826,587273..588043))
Genome map
NT seq 951 nt NT seq  +upstreamnt  +downstreamnt
atgaccccaacaacctatctcagctttgcaatcctgactctatttcttgttgttatcgat
atttggcaaacccgtggcggtaaagtcacgatcactaaagcggccgtttggagcgtgatt
tggtttatgctggcgtttgcattcgccgcgagtatctatttcttttgggatagttacgca
ccaaccagttcatacagtgccgaaaaggcgacgatctcgtttattactggttacttgtta
gaaaaatcgttaagtgttgataacttattcgtctttgcgattatttttcatcaatacgca
gtccctgagcatttacgcccgcgggctctattgtggggagtgatcggcgctttgtgttta
cgagcggtgatgattgtgattggtgcacagctacttgaacaatatcattggttactttat
gtgtttgcattatttcttatgtggaccggtattcaacttgcgcgtgagaaaggcgatgaa
cagctaaacccaatgccggagaaactgattcgacgctggttcaatgtgacggatcattac
gaagggaatgctttggttgtgagccgcaataagcaatggtttgtgactccaatgatgatt
gtgattggcgtgattgcttttatggatgtcatgttcgcattagattcaataccggctatt
tttgccgtgacccgcgaaccctttttagtgttagctgcgaacgtgtttgcgttacttggt
ttgcgatctttgtactttgtgttgcaagggatgatggataagtttatttatctaaaacca
gcgctttccttcatcatgatcttcattggtattaagatgatgctagtcggttctgcgtgg
gaaattccgacaccagtctcactgggtgtattgttagtcactatgattattgcggtgttg
gcttctgtctataagcagagaagtccattacctgctactcataagtcataa

DBGET integrated database retrieval system