KEGG   Viruses: 3077566
Entry
3077566           CDS       T40000                                 

Gene name
UL146, HHV5wtgp117
Definition
(RefSeq) Human betaherpesvirus 5; chemokine vCXCL1
  KO
K21046  HCMV chemokine vCXCL1
Taxonomy
TAX:10359 [GN:T40080]
  Lineage
Viruses; dsDNA viruses; Duplodnaviria; Heunggongvirae; Peploviricota; Herviviricetes; Herpesvirales; Herpesviridae; Betaherpesvirinae; Cytomegalovirus
Organism
vg  Viruses (Human betaherpesvirus 5)
SSDB
Other DBs
NCBI-GeneID: 3077566
NCBI-ProteinID: YP_081571
RS: NC_006273
UniProt: F5HBX1 Q5SEA4
LinkDB
Position
NC_006273:complement(180930..181292)
AA seq 120 aa
MRLIFGALIISLTYMYYYEVHGTELRCKCLDGKKLPPKTIMLGNFWFHRESGGPRCNNNE
YFLYLGGGKKHGPGVCLSPHHPFSKWLDKRNDNRWYNVNVTRQPERGPGKITVTLVGLKE
NT seq 363 nt   +upstreamnt  +downstreamnt
atgcgattaatttttggtgcgttgattatttctttaacgtatatgtattattatgaagtg
catggaacggaattacgctgcaaatgtcttgatggtaaaaaactgccgcccaaaacaatt
atgttgggtaatttttggtttcatcgcgaatctggtggtcccagatgcaataacaatgaa
tatttcttgtatctaggcggaggaaaaaaacatggacctggagtatgtttatcgccccat
caccctttttcaaaatggctagacaaacgcaacgataacaggtggtataatgttaatgta
acaagacaaccggaacgagggccgggaaaaataactgtaaccctagtaggtctgaaggaa
taa

DBGET integrated database retrieval system