KEGG   Viruses: 4961474Help
Entry
4961474           CDS       T40000                                 

Gene name
ORF45, HHV8GK18_gp51
Definition
(RefSeq) Human gammaherpesvirus 8; ORF45
  KO
K21859  KSHV transcription activator ORF45
Taxonomy
TAX:37296 [GN:T40081]
  Lineage
Viruses; dsDNA viruses; Herpesvirales; Herpesviridae; Gammaherpesvirinae; Rhadinovirus
Taxonomy
Organism
vg  Viruses (Human gammaherpesvirus 8)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4961474
NCBI-ProteinID: YP_001129397
RS: NC_009333
UniProt: F5HDE4 Q77UV9
LinkDB All DBs
Position
NC_009333:complement(67452..68675)
AA seq 407 aa AA seqDB search
MAMFVRTSSSTHDEERMLPIEGAPRRRPPVKFIFPPPPLSSLPGFGRPRGYAGPTVIDMS
APDDVFAEDTPSPPATPLDLQISPDQSSGESEYDEDEEDEDEEENDDVQEEDEPEGYPAD
FFQPLSHLRPRPLARRAHTPKPVAVVAGRVRSSTDTAESEASMGWVSQDDGFSPAGLSPS
DDEGVAILEPMAAYTGTGAYGLSPASRNSVPGTQSSPYSDPDEGPSWRPLRAAPTAIVDL
TSDSDSDDSSNSPDVNNEAAFTDARHFSHQPPSSEEDGEDQGEVLSQRIGLMDVGQKRKR
QSTASSGSEDVVRCQRQPNLSRKAVASVIIISSGSDTDEEPSSAVSVIVSPSSTKGHLPT
QSPSTSAHSISSGSTTTAGSRCSDPTRILASTPPLCGNGAYNWPWLD
NT seq 1224 nt NT seq  +upstreamnt  +downstreamnt
atggcgatgtttgtgaggacctcgtctagcacacacgatgaagagagaatgcttccaatt
gaaggagcgcctcgcagacgaccccccgtgaagttcatattcccacctccacctctttca
tcacttccaggatttggcaggccgcgcggctatgctggacccacggtgatagatatgtct
gccccagacgacgtcttcgccgaggacacgccatcgccgccagcaacccctctggatcta
cagatatccccggatcagtcgagcggcgaatctgaatatgacgaggatgaggaagatgaa
gatgaagaagaaaatgacgatgttcaggaggaagacgagccagaggggtaccctgcagac
ttttttcaacctttatctcacttgcgcccgaggcctctggccagacgggcccatacgccc
aaaccggtagcagtggtagcgggccgcgtgcgcagttcaacggacacggcggagtccgag
gcgtccatgggatgggttagtcaggatgacggattttcccctgctgggctctcaccttca
gacgacgagggggttgctatcctggaaccgatggcggcatacactgggaccggggcatac
ggactttcacctgcttccagaaatagtgtacctggaacacaaagttcaccatacagcgac
cctgatgaagggccctcgtggcgccccctgcgcgccgcacccaccgcgatcgtcgacctg
acatcggactctgatagcgatgacagttccaactctccggacgtgaacaatgaggccgcg
tttaccgacgcgcgccatttttcccaccagccaccctcgtccgaggaggacggagaagac
caaggggaagtattgagtcagagaatcgggctcatggacgtgggccagaagcgcaaaagg
cagtctaccgcctcctctggtagcgaggatgtggtgcgctgccagagacaaccaaactta
agccgcaaagcagtggcgtctgtgataattatatcctcggggagtgacacagacgaggag
ccctcgtccgccgtgagcgtgatcgtgtctccgtcgagcacaaagggtcacctcccaacc
caatctcccagtacttccgcccactcgatttcatcaggaagcacaactaccgcggggtcc
aggtgcagcgacccaacccgcatcctggcctccacgccacccctgtgtggaaacggtgca
tataactggccgtggctggactga

DBGET integrated database retrieval system