KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02040Help
Entry
VVMO6_02040       CDS       T01415                                 

Definition
(GenBank) superoxide dismutase (Fe)
  KO
K04564  superoxide dismutase, Fe-Mn family [EC:1.15.1.1]
Organism
vvm  Vibrio vulnificus MO6-24/O
Brite
Enzymes [BR:vvm01000]
 1. Oxidoreductases
  1.15  Acting on superoxide as acceptor
   1.15.1  Acting on superoxide as acceptor (only sub-subclass identified to date)
    1.15.1.1  superoxide dismutase
     VVMO6_02040
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV87062
LinkDB All DBs
Position
I:2187374..2187958
Genome map
AA seq 194 aa AA seqDB search
MAFELPALPYAKDALEPHISAETLEFHHGKHHNTYVVKLNGLIPGTEFEGKTLEEIIKTS
TGGIFNNAAQVWNHTFYWHCLAPNAGGEPTGAVAEAINAAFGSFEEFKAKFTDSAINNFG
SSWTWLVKKADGSLAIVNTSNAATPITEEGVTPLLTVDLWEHAYYIDYRNLRPDYMNGFW
ALVNWDFVAENLAK
NT seq 585 nt NT seq  +upstreamnt  +downstreamnt
atggcatttgaactaccagctcttccttacgcaaaagacgcgcttgagccacacatctct
gcagaaactcttgagttccaccacggcaaacaccacaacacttacgttgtgaaactgaac
ggcctaattcctggtactgaattcgaaggtaaaactctagaagagatcatcaagacttct
acaggcggtatcttcaacaacgcagcgcaagtatggaaccacactttctactggcactgt
cttgctccaaacgcaggcggcgagccaacaggtgcagttgcagaagcgatcaacgcagca
ttcggttcattcgaagagttcaaagcaaaattcacggattcagcaatcaacaactttggt
tcatcttggacttggttggtgaagaaagcagacggttctctagcaatcgttaacacttca
aatgcggcaacaccaatcactgaagaaggcgtaactccactactgactgtagacctatgg
gaacacgcttactacatcgattaccgcaacctacgtcctgactacatgaacggtttctgg
gcactggttaactgggatttcgttgcagagaacctagcgaaataa

DBGET integrated database retrieval system