KEGG   Azotobacter chroococcum: Achr_12170
Entry
Achr_12170        tRNA      T03640                                 
Name
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_12170
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_12170
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_12170
SSDB
LinkDB
Position
1343189..1343259
NT seq 71 nt   +upstreamnt  +downstreamnt
gcgggcgtcgtataatggcattacctgagcttcccaagctcatgacgagggttcgattcc
cttcgcccgct

KEGG   Azotobacter chroococcum: Achr_20110
Entry
Achr_20110        tRNA      T03640                                 
Name
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_20110
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_20110
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_20110
SSDB
LinkDB
Position
2241592..2241664
NT seq 73 nt   +upstreamnt  +downstreamnt
gcgggaatagctcagttggtagagcacgaccttgccaaggtcggggtcgcgagttcgagt
ctcgtttcccgct

KEGG   Azotobacter chroococcum: Achr_27290
Entry
Achr_27290        tRNA      T03640                                 
Name
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_27290
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_27290
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_27290
SSDB
LinkDB
Position
complement(3088288..3088360)
NT seq 73 nt   +upstreamnt  +downstreamnt
gcgggaatagctcagttggtagagcacgaccttgccaaggtcggggtcgcgagttcgagt
ctcgtttcccgct

KEGG   Azotobacter chroococcum: Achr_27300
Entry
Achr_27300        tRNA      T03640                                 
Name
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_27300
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_27300
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_27300
SSDB
LinkDB
Position
complement(3088482..3088554)
NT seq 73 nt   +upstreamnt  +downstreamnt
gcgggaatagctcagttggtagagcacgaccttgccaaggtcggggtcgcgagttcgagt
ctcgtttcccgct

KEGG   Azotobacter chroococcum: Achr_35270
Entry
Achr_35270        tRNA      T03640                                 
Name
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_35270
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_35270
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_35270
SSDB
LinkDB
Position
complement(3914581..3914651)
NT seq 71 nt   +upstreamnt  +downstreamnt
gcgggtatagttcagtggtagaacctcagccttccaagctgatgatgcgggttcgattcc
cgctacccgct

DBGET integrated database retrieval system