KEGG   Azotobacter chroococcum: Achr_13010
Entry
Achr_13010        tRNA      T03640                                 
Name
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13010
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13010
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13010
SSDB
LinkDB
Position
1431641..1431713
NT seq 73 nt   +upstreamnt  +downstreamnt
gggtcgttagctcagtcggtagagcagttggcttttaaccaattggtcgtaggttcgaat
cctacacgaccca

KEGG   Azotobacter chroococcum: Achr_30580
Entry
Achr_30580        tRNA      T03640                                 
Name
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_30580
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_30580
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_30580
SSDB
LinkDB
Position
complement(3427979..3428051)
NT seq 73 nt   +upstreamnt  +downstreamnt
gggtcgttagctcagtcggtagagcagttggcttttaaccaattggtcgtaggttcgaat
cctacacgaccca

DBGET integrated database retrieval system