KEGG   Azotobacter chroococcum: Achr_13210
Entry
Achr_13210        tRNA      T03640                                 
Name
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13210
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13210
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13210
SSDB
LinkDB
Position
1452349..1452421
NT seq 73 nt   +upstreamnt  +downstreamnt
gggtgattagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgatc
ccgtcatcaccca

KEGG   Azotobacter chroococcum: Achr_14260
Entry
Achr_14260        tRNA      T03640                                 
Name
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_14260
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_14260
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_14260
SSDB
LinkDB
Position
1564692..1564764
NT seq 73 nt   +upstreamnt  +downstreamnt
ggctgattagctcagctgggagagcacctgcatcacacgcagggggtcggcggttcgatc
ccgtcatcagcca

KEGG   Azotobacter chroococcum: Achr_24650
Entry
Achr_24650        tRNA      T03640                                 
Name
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_24650
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_24650
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_24650
SSDB
LinkDB
Position
complement(2768362..2768435)
NT seq 74 nt   +upstreamnt  +downstreamnt
aggcacatagctcagttggttagagcaccaccttgacatggtgggggtcgttggttcgag
tccaattgtgccta

DBGET integrated database retrieval system