KEGG   Azotobacter chroococcum: Achr_13220
Entry
Achr_13220        tRNA      T03640                                 
Name
(GenBank) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13220
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13220
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13220
SSDB
LinkDB
Position
1452437..1452510
NT seq 74 nt   +upstreamnt  +downstreamnt
gcagcggtagttcagtcggttagaataccggcctgtcacgccgggggtcgcgggttcgag
tcccgtccgctgcg

KEGG   Azotobacter chroococcum: Achr_14270
Entry
Achr_14270        tRNA      T03640                                 
Name
(GenBank) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_14270
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_14270
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_14270
SSDB
LinkDB
Position
1564804..1564877
NT seq 74 nt   +upstreamnt  +downstreamnt
gcagcggtagttcagtcggttagaataccggcctgtcacgccgggggtcgcgggttcgag
tcccgtccgctgcg

DBGET integrated database retrieval system