KEGG   Azotobacter chroococcum: Achr_13950
Entry
Achr_13950        tRNA      T03640                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13950
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13950
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13950
SSDB
LinkDB
Position
1531026..1531099
NT seq 74 nt   +upstreamnt  +downstreamnt
gcactcatagctcagctggatagagtacccggctacgaaccgggcggtcggaggttcgaa
tcctcctgagtgcg

KEGG   Azotobacter chroococcum: Achr_13960
Entry
Achr_13960        tRNA      T03640                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13960
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13960
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13960
SSDB
LinkDB
Position
1531168..1531241
NT seq 74 nt   +upstreamnt  +downstreamnt
gcactcatagctcagctggatagagtacccggctacgaaccgggcggtcggaggttcgaa
tcctcctgagtgcg

KEGG   Azotobacter chroococcum: Achr_13985
Entry
Achr_13985        tRNA      T03640                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_13985
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_13985
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_13985
SSDB
LinkDB
Position
1534520..1534595
NT seq 76 nt   +upstreamnt  +downstreamnt
tgtccccttagttcaatggatagaacaagcccctcctaagggctagatgctggttcgact
ccagcagggggcgcca

KEGG   Azotobacter chroococcum: Achr_23000
Entry
Achr_23000        tRNA      T03640                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_23000
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_23000
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_23000
SSDB
LinkDB
Position
complement(2562302..2562375)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcagctggatagagcatccgccttctaagcggatggtcgcaggttcgag
tcctgccgggtgcg

KEGG   Azotobacter chroococcum: Achr_2700
Entry
Achr_2700         tRNA      T03640                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_2700
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_2700
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_2700
SSDB
LinkDB
Position
complement(280041..280114)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgctcgtagctcagctggatagagtactgccctccgaaggcaggggtcgtgggttcgaa
tcccgccgagcgcg

DBGET integrated database retrieval system