KEGG   Azotobacter chroococcum: Achr_15110
Entry
Achr_15110        tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_15110
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_15110
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_15110
SSDB
LinkDB
Position
1660144..1660217
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

KEGG   Azotobacter chroococcum: Achr_1780
Entry
Achr_1780         tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_1780
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_1780
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_1780
SSDB
LinkDB
Position
186979..187052
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

KEGG   Azotobacter chroococcum: Achr_22580
Entry
Achr_22580        tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_22580
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_22580
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_22580
SSDB
LinkDB
Position
complement(2524751..2524824)
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

KEGG   Azotobacter chroococcum: Achr_28680
Entry
Achr_28680        tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_28680
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_28680
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_28680
SSDB
LinkDB
Position
complement(3227863..3227936)
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

KEGG   Azotobacter chroococcum: Achr_5590
Entry
Achr_5590         tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_5590
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_5590
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_5590
SSDB
LinkDB
Position
610921..610994
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

KEGG   Azotobacter chroococcum: Achr_8220
Entry
Achr_8220         tRNA      T03640                                 
Name
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_8220
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_8220
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_8220
SSDB
LinkDB
Position
916148..916221
NT seq 74 nt   +upstreamnt  +downstreamnt
gggtctgtagctcagttggttagagcgcacccctgataagggtgaggtcggcagttcgaa
tctgcccagaccca

DBGET integrated database retrieval system