KEGG   Azotobacter chroococcum: Achr_15120
Entry
Achr_15120        tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_15120
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_15120
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_15120
SSDB
LinkDB
Position
1660265..1660337
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

KEGG   Azotobacter chroococcum: Achr_1790
Entry
Achr_1790         tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_1790
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_1790
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_1790
SSDB
LinkDB
Position
187100..187172
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

KEGG   Azotobacter chroococcum: Achr_22570
Entry
Achr_22570        tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_22570
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_22570
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_22570
SSDB
LinkDB
Position
complement(2524631..2524703)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

KEGG   Azotobacter chroococcum: Achr_25470
Entry
Achr_25470        tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_25470
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_25470
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_25470
SSDB
LinkDB
Position
complement(2858901..2858973)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggctatagctcagctgggagagcgcttgcatggcatgcaagaggtcgacggttcgatc
ccgtctagctcca

KEGG   Azotobacter chroococcum: Achr_25490
Entry
Achr_25490        tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_25490
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_25490
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_25490
SSDB
LinkDB
Position
complement(2859160..2859232)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggctatagctcagctgggagagcgcttgcatggcatgcaagaggtcgacggttcgatc
ccgtctagctcca

KEGG   Azotobacter chroococcum: Achr_28670
Entry
Achr_28670        tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_28670
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_28670
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_28670
SSDB
LinkDB
Position
complement(3227743..3227815)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

KEGG   Azotobacter chroococcum: Achr_5600
Entry
Achr_5600         tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_5600
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_5600
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_5600
SSDB
LinkDB
Position
611042..611114
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

KEGG   Azotobacter chroococcum: Achr_8230
Entry
Achr_8230         tRNA      T03640                                 
Name
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_8230
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_8230
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_8230
SSDB
LinkDB
Position
916269..916341
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgcctgctttgcacgcaggaggtcaggagttcgatc
ctccttggctcca

DBGET integrated database retrieval system